plentiCRISPv2_FDX1-2
(Plasmid
#184489)
-
PurposeLentivirus all in one CRISPR vector targeting human FDX1 gene
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184489 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneplentiCRISPv2
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFDX1
-
gRNA/shRNA sequenceCACCGAGCGGCCTGCTGAGGAACCG
-
SpeciesH. sapiens (human)
-
Entrez GeneFDX1 (a.k.a. ADX, FDX, LOH11CR1D)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
plentiCRISPv2_FDX1-2 was a gift from Todd Golub & Peter Tsvetkov (Addgene plasmid # 184489 ; http://n2t.net/addgene:184489 ; RRID:Addgene_184489) -
For your References section:
Copper induces cell death by targeting lipoylated TCA cycle proteins. Tsvetkov P, Coy S, Petrova B, Dreishpoon M, Verma A, Abdusamad M, Rossen J, Joesch-Cohen L, Humeidi R, Spangler RD, Eaton JK, Frenkel E, Kocak M, Corsello SM, Lutsenko S, Kanarek N, Santagata S, Golub TR. Science. 2022 Mar 18;375(6586):1254-1261. doi: 10.1126/science.abf0529. Epub 2022 Mar 17. 10.1126/science.abf0529 PubMed 35298263