Skip to main content
Addgene

pLenti_Ef1a:PE2-P2A-GFP
(Plasmid #184445)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184445 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLV
  • Backbone manufacturer
    SignaGen Inc
  • Backbone size (bp) 14972
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Promoter U6 and Ef1A

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GTGCAGGGGAAAGAATAGTAGACA
  • 3′ sequencing primer CGTAGAACCCAGAGATCGCT
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    SignaGen Laboratories

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Backbone was generated by Signagen by cloning PE2-P2A-GFP (Addgene #132776) insert in a pLV backbone. Further addition of PaqCI sites are performed in our lab.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti_Ef1a:PE2-P2A-GFP was a gift from Bobby Koeleman (Addgene plasmid # 184445 ; http://n2t.net/addgene:184445 ; RRID:Addgene_184445)

  • For your References section:

    Increased prime edit rates in KCNQ2 and SCN1A via single nicking all-in-one plasmids. Dirkx N, Weuring WJ, De Vriendt E, Smal N, van de Vondervoort J, van 't Slot R, Koetsier M, Zonnekein N, De Pooter T, Weckhuysen S, Koeleman BPC. BMC Biol. 2023 Jul 13;21(1):156. doi: 10.1186/s12915-023-01646-7. 10.1186/s12915-023-01646-7 PubMed 37443005
Related items:
Commonly requested with: