Skip to main content
Addgene

gRNA-MS2x2-TagRFP657
(Plasmid #184441)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184441 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLKO.1
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA-MS2x2, TagRFP657

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer gaatagagttaggcagggatattc
  • 3′ sequencing primer CCTATAGTGAGTCGTATTA
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    gRNA-MS2x2-TagRFP657 was a gift from Rhys Allan (Addgene plasmid # 184441 ; http://n2t.net/addgene:184441 ; RRID:Addgene_184441)

  • For your References section:

    Activation of stably silenced genes by recruitment of a synthetic de-methylating module. Chan WF, Coughlan HD, Chen Y, Keenan CR, Smyth GK, Perkins AC, Johanson TM, Allan RS. Nat Commun. 2022 Sep 23;13(1):5582. doi: 10.1038/s41467-022-33181-4. 10.1038/s41467-022-33181-4 PubMed 36151095
Related items:
Commonly requested with: