pX459-sgAAVS1
(Plasmid #184403)

• Purpose: pX459 (sgRNA and Cas9 expressing plasmid, RRID:Addgene_62988) with targeting sequence specific to AAVS1; targeting sequence is: GGGGCCACTAGGGACAGGAT
• Depositing Lab: Robert Bradley
• Publication: Udy et al Life Sci Alliance. 2021 Dec 8;5(3). pii: 5/3/e202101217. doi: 10.26508/lsa.202101217. Print 2022 Mar.

Backbone

• Vector backbone: pX459
• Backbone size w/o insert (bp): 9158
• Total vector size (bp): 9178
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: AAVS1-specific sgRNA
• gRNA/shRNA sequence: GGGGCCACTAGGGACAGGAT
• Species: H. sapiens (human)
• Insert Size (bp): 20
• Promoter: U6 promoter

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GAGGGCCTATTTCCCATGAT

Resource Information

• Supplemental Documents:
  • pX459-sgAAVS1.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

sgRNA 20 bp targeting sequence is specific for AAVS1. Express this plasmid in cultured human cells to induce Cas9-mediated cutting of AAVS1; include donor plasmid with AAVS1-specific homology arms to stably integrate DNA at AAVS1 locus.