AAVS1-TetOn-3XFLAG-firefly-beta-globin-PTC39-AAVS1
(Plasmid #184397)

• Purpose: Donor plasmid for stable integration of firefly luciferase NMD(+) PTC39 reporter at AAVS1
• Depositing Lab: Robert Bradley
• Publication: Udy et al Life Sci Alliance. 2021 Dec 8;5(3). pii: 5/3/e202101217. doi: 10.26508/lsa.202101217. Print 2022 Mar.

Backbone

• Vector backbone: pBluescript
• Backbone size w/o insert (bp): 9318
• Total vector size (bp): 12349
• Vector type: Mammalian Expression, CRISPR ; Donor plasmid for HDR
• Selectable markers: Neomycin (select with G418), Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Firefly luciferase beta-globin-PTC39
• Alt name: Firefly luciferase NMD(+) reporter
• Species: H. sapiens (human), M. musculus (mouse); Photinus pyralis
• Insert Size (bp): 3031
• Mutation: PTC in beta-globin at amino acid position 39
• Promoter: Tet-On 3G
• Tag / Fusion Protein:
  • 3X FLAG (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (destroyed during cloning)
• 3′ cloning site: BglII (destroyed during cloning)
• 5′ sequencing primer: AGTGCAGGTGCCAGAACATT
• 3′ sequencing primer: CAGCTCCTGGGCAATATGAT

Resource Information

• Supplemental Documents:
  • AAVS1-TetOn-3XFLAG-firefly-beta-globin-PTC39-AAVS1.gbk
• A portion of this plasmid was derived from a plasmid made by: The 3X-FLAG firefly luciferase beta-globin-PTC39 insert sequence is from a plasmid from James Inglese's lab (Addgene catalog # 112084, published in PMID: 29528287).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The backbone is from a plasmid from Masato Kanemaki’s lab (Addgene catalog # 72835, published in PMID: 27052166). The 3X-FLAG firefly luciferase beta-globin-PTC39 insert sequence replaces the OsTIR1 sequence in that plasmid. Additional cloning details are available in Udy et al., 2021 (PMID: 34880103).