AAVS1-TetOn-3XFLAG-renilla-beta-globin-control-AAVS1
(Plasmid
#184396)
-
PurposeDonor plasmid for stable integration of Renilla luciferase control reporter at AAVS1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184396 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBluescript
- Backbone size w/o insert (bp) 9318
- Total vector size (bp) 11632
-
Vector typeMammalian Expression, CRISPR ; Donor plasmid for HDR
-
Selectable markersNeomycin (select with G418), Puromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRenilla luciferase beta-globin
-
Alt nameRenilla luciferase control reporter
-
SpeciesH. sapiens (human), M. musculus (mouse); Renilla reniformis
-
Insert Size (bp)2314
- Promoter Tet-On 3G
-
Tag
/ Fusion Protein
- 3X FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (destroyed during cloning)
- 3′ cloning site BglII (destroyed during cloning)
- 5′ sequencing primer AGTGCAGGTGCCAGAACATT
- 3′ sequencing primer CAGCTCCTGGGCAATATGAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe 3X-FLAG Renilla luciferase beta-globin insert sequence is from a transient transfection plasmid from this same study (Addgene catalog # 184393, published in PMID: 34880103).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The backbone is from a plasmid from Masato Kanemaki’s lab (Addgene catalog # 72835, published in PMID: 27052166). The 3X-FLAG Renilla luciferase beta-globin insert sequence replaces the OsTIR1 sequence in that plasmid. Additional cloning details are available in Udy et al., 2021 (PMID: 34880103).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1-TetOn-3XFLAG-renilla-beta-globin-control-AAVS1 was a gift from Robert Bradley (Addgene plasmid # 184396 ; http://n2t.net/addgene:184396 ; RRID:Addgene_184396) -
For your References section:
Nonsense-mediated mRNA decay uses complementary mechanisms to suppress mRNA and protein accumulation. Udy DB, Bradley RK. Life Sci Alliance. 2021 Dec 8;5(3). pii: 5/3/e202101217. doi: 10.26508/lsa.202101217. Print 2022 Mar. 10.26508/lsa.202101217 PubMed 34880103