pAT15547_PEmax-SuperFi-Cas9
(Plasmid
#184377)
-
PurposeMammalian expression of SuperFi-Cas9 PEmax prime editor
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184377 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC19
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePEmax-SuperFi-Cas9
-
Alt nameSuperFi-Cas9(H840A) fused with the codon optimized MMLV reverse transcriptase - prime editor PEmax
-
SpeciesS. pyogenes
-
MutationH840A, R221K, N394K, Y1010D, Y1013D, Y1016D, V1018D, R1019D, Q1027D, K1031D
- Promoter CMV
-
Tags
/ Fusion Proteins
- SV40 NLS (N terminal on insert)
- c-myc NLS (C terminal on insert)
- SV40 NLS (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AAAACAGGAAGGCAAAATGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.05.27.493683v1.full for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAT15547_PEmax-SuperFi-Cas9 was a gift from Ervin Welker (Addgene plasmid # 184377 ; http://n2t.net/addgene:184377 ; RRID:Addgene_184377) -
For your References section:
SuperFi-Cas9 exhibits remarkable fidelity but severely reduced activity yet works effectively with ABE8e. Kulcsar PI, Talas A, Ligeti Z, Krausz SL, Welker E. Nat Commun. 2022 Nov 11;13(1):6858. doi: 10.1038/s41467-022-34527-8. 10.1038/s41467-022-34527-8 PubMed 36369279