Skip to main content
Addgene

pCMV10-3xFLAG-prs-MCP1
(Plasmid #184341)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184341 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCMV10
  • Backbone size w/o insert (bp) 6281
  • Total vector size (bp) 7190
  • Modifications to backbone
    Digested with NotI and BamHI
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Yeast MCP1
  • Alt name
    MDM10 complementing protein 1
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    909
  • GenBank ID
    NC_001147.6 YOR228C
  • Entrez Gene
    MCP1 (a.k.a. YOR228C)
  • Promoter CMV
  • Tag / Fusion Protein
    • 3xFLAG-PreScission cleavage site (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer aggggccccttgcggccgccATGATAAAGTTGCATGAAGTGCC
  • 3′ sequencing primer agggatgccacccgggatccctaattcacgtgcaacagc
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV10-3xFLAG-prs-MCP1 was a gift from Karin Reinisch (Addgene plasmid # 184341 ; http://n2t.net/addgene:184341 ; RRID:Addgene_184341)

  • For your References section:

    Structural and biochemical insights into lipid transport by VPS13 proteins. Adlakha J, Hong Z, Li P, Reinisch KM. J Cell Biol. 2022 Jun 6;221(5):e202202030. doi: 10.1083/jcb.202202030. Epub 2022 Mar 31. 10.1083/jcb.202202030 PubMed 35357422
Related items:
Commonly requested with: