pAAV-hsyn-DIO-GCaMP6s
(Plasmid
#184284)
-
PurposeExpresses GCaMP6s in genetically defined neurons expressing Cre recombinase
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184284 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC
- Backbone size w/o insert (bp) 2900
- Total vector size (bp) 6192
-
Vector typeMammalian Expression, Mouse Targeting, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCCaMP6s
-
SpeciesSynthetic
-
Insert Size (bp)3400
- Promoter human synaptophysin
-
Tag
/ Fusion Protein
- EGFP
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ctgactgaagagcagatcgcag
- 3′ sequencing primer ctcactcgagaacgtctatatc
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe GCaMP6s was from Addgene plasmid ID#: 40753, Douglas Kim lab
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hsyn-DIO-GCaMP6s was a gift from William Wisden (Addgene plasmid # 184284 ; http://n2t.net/addgene:184284 ; RRID:Addgene_184284) -
For your References section:
GABA and glutamate neurons in the VTA regulate sleep and wakefulness. Yu X, Li W, Ma Y, Tossell K, Harris JJ, Harding EC, Ba W, Miracca G, Wang D, Li L, Guo J, Chen M, Li Y, Yustos R, Vyssotski AL, Burdakov D, Yang Q, Dong H, Franks NP, Wisden W. Nat Neurosci. 2019 Jan;22(1):106-119. doi: 10.1038/s41593-018-0288-9. Epub 2018 Dec 17. 10.1038/s41593-018-0288-9 PubMed 30559475