Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-hsyn-DIO-GCaMP6s
(Plasmid #184284)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184284 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC
  • Backbone size w/o insert (bp) 2900
  • Total vector size (bp) 6192
  • Vector type
    Mammalian Expression, Mouse Targeting, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CCaMP6s
  • Species
    Synthetic
  • Insert Size (bp)
    3400
  • Promoter human synaptophysin
  • Tag / Fusion Protein
    • EGFP

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ctgactgaagagcagatcgcag
  • 3′ sequencing primer ctcactcgagaacgtctatatc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The GCaMP6s was from Addgene plasmid ID#: 40753, Douglas Kim lab
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hsyn-DIO-GCaMP6s was a gift from William Wisden (Addgene plasmid # 184284 ; http://n2t.net/addgene:184284 ; RRID:Addgene_184284)
  • For your References section:

    GABA and glutamate neurons in the VTA regulate sleep and wakefulness. Yu X, Li W, Ma Y, Tossell K, Harris JJ, Harding EC, Ba W, Miracca G, Wang D, Li L, Guo J, Chen M, Li Y, Yustos R, Vyssotski AL, Burdakov D, Yang Q, Dong H, Franks NP, Wisden W. Nat Neurosci. 2019 Jan;22(1):106-119. doi: 10.1038/s41593-018-0288-9. Epub 2018 Dec 17. 10.1038/s41593-018-0288-9 PubMed 30559475