Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDS2149
(Plasmid #184275)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184275 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pDS2142
  • Total vector size (bp) 10076
  • Modifications to backbone
    Replacement of the Tet-on system by Te-off, replacement of SAT1 dominant marker by HygR dominant marker
  • Vector type
    Yeast Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CatrTA
  • Alt name
    Tet-on system
  • Species
    Synthetic
  • Insert Size (bp)
    984
  • Promoter TDH3

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer CATCAACAAACTTTACAATC
  • 3′ sequencing primer AAAACCAGATTTCCAGATTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDS2149 was a gift from Dominique Sanglard (Addgene plasmid # 184275 ; http://n2t.net/addgene:184275 ; RRID:Addgene_184275)
Commonly requested with: