pDS2149
(Plasmid #184275)

• Purpose: Tet-on genome insertion system
• Depositing Lab: Dominique Sanglard
• Publication: Tet-on gene expression system for Candida albicans (unpublished)

Backbone

• Vector backbone: pDS2142
• Total vector size (bp): 10076
• Modifications to backbone: Replacement of the Tet-on system by Te-off, replacement of SAT1 dominant marker by HygR dominant marker
• Vector type: Yeast Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CatrTA
• Alt name: Tet-on system
• Species: Synthetic
• Insert Size (bp): 984
• Promoter: TDH3

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: CATCAACAAACTTTACAATC
• 3′ sequencing primer: AAAACCAGATTTCCAGATTT

Resource Information

• Supplemental Documents:
  • pDS2149.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry