ATX3-77Q
(Plasmid #184249)

• Purpose: Recombinant protein expression and purification. Encodes ataxin-3 full length with 3 UIMs and 77Q in the Poly-Q track fused with His-Tag and TEV cleavage sequence (N-terminal)
• Depositing Lab: Sandra Macedo Ribeiro
• Publication: Figueiredo et al Cells. 2022 Jun 19;11(12). pii: cells11121969. doi: 10.3390/cells11121969.

Backbone

• Vector backbone: pDEST17
• Backbone manufacturer: pDEST, Gateway T7 Vectors
• Backbone size w/o insert (bp): 6354
• Modifications to backbone: Inclusion of a TEV cleavage site after the 6x HIS-tag
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Ataxin-3 full length with 3 UIMs and 77Q in the Poly-Q track
• Alt name: ATXN3
• Alt name: SCA3
• Alt name: MJD
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 1332
• Mutation: Codon optimization for protein expression in BL21, insertion of 67 codons encoding Q in the Poly-Q track
• Entrez Gene: ATXN3 (a.k.a. AT3, ATX3, JOS, MJD, MJD1, SCA3)
• Promoter: T7 promoter
• Tags / Fusion Proteins:
  • 6x His-Tag (N terminal on insert)
  • TEV cleavage site (N terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: T7- TAATACGACTCACTATAGGG
• 3′ sequencing primer: T7 term- GCTAGTTATTGCTCAGCGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry