ATX3-13Q
(Plasmid
#184248)
-
PurposeRecombinant protein expression and purification. Encodes ataxin-3 full length with 3 UIMs and 13Q in the Poly-Q track fused with His-Tag and TEV cleavage sequence (N-terminal)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184248 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDEST17
-
Backbone manufacturerpDEST, Gateway T7 Vectors
- Backbone size w/o insert (bp) 6354
-
Modifications to backboneInclusion of a TEV cleavage site after the 6x HIS-tag
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameataxin-3 full length with 3 UIMs and 13Q in the Poly-Q track
-
Alt nameATXN3
-
Alt nameSCA3
-
Alt nameMJD
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1140
-
MutationC-terminal codon optimization for protein expression in BL21
-
Entrez GeneATXN3 (a.k.a. AT3, ATX3, JOS, MJD, MJD1, SCA3)
- Promoter T7 promoter
-
Tags
/ Fusion Proteins
- 6x His-Tag (N terminal on insert)
- TEV cleavage site (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer T7- TAATACGACTCACTATAGGG
- 3′ sequencing primer T7 term- GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ATX3-13Q was a gift from Sandra Macedo Ribeiro (Addgene plasmid # 184248 ; http://n2t.net/addgene:184248 ; RRID:Addgene_184248) -
For your References section:
A Robust Assay to Monitor Ataxin-3 Amyloid Fibril Assembly. Figueiredo F, Lopes-Marques M, Almeida B, Matscheko N, Martins PM, Silva A, Macedo-Ribeiro S. Cells. 2022 Jun 19;11(12). pii: cells11121969. doi: 10.3390/cells11121969. 10.3390/cells11121969 PubMed 35741099