Skip to main content
Addgene

pEGFP-H2B-MCS
(Plasmid #184041)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184041 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size (bp) 4731
  • Modifications to backbone
    Inserted human H2B N-terminal to EGFP
  • Vector type
    Mammalian Expression
  • Promoter CMV
  • Selectable markers
    Neomycin (select with G418)
  • Tags / Fusion Proteins
    • GFP (N terminal on backbone)
    • H2B (N terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer CAACGGGACTTTCCAAAATG
  • 3′ sequencing primer CCTCTACAAATGTGGTATGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-H2B-MCS was a gift from Lienhard Schmitz (Addgene plasmid # 184041 ; http://n2t.net/addgene:184041 ; RRID:Addgene_184041)

  • For your References section:

    The Aurora B-controlled PP1/RepoMan complex determines the spatial and temporal distribution of mitotic H2B S6 phosphorylation. Pfisterer M, Robert R, Saul VV, Pritz A, Seibert M, Feederle R, Schmitz ML. Open Biol. 2024 May;14(5):230460. doi: 10.1098/rsob.230460. Epub 2024 May 29. 10.1098/rsob.230460 PubMed 38806145
Related items: