-
PurposeCAG-hyperCas12a(nuclease active)-HA-P2A-mCherry-T2A-HygroR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 183964 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePB
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersHygromycin ; mCherry fluorescence
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHyperdCas12a
-
Alt nameLbCas12a(D156R, E292R, D235R, D350R)
-
Alt nameLbCfp1(D156R, E292R, D235R, D350R)
-
SpeciesSynthetic
-
MutationD156R, E292R, D235R, D350R
- Promoter CAG
-
Tags
/ Fusion Proteins
- HA (C terminal on insert)
- mCherry (C terminal on insert)
- Hygromycin Resistance (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer caacgtgctggttgttgtgctg
- 3′ sequencing primer GGAAAGGACAGTGGGAGTGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLQ10878 was a gift from Stanley Qi (Addgene plasmid # 183964 ; http://n2t.net/addgene:183964 ; RRID:Addgene_183964) -
For your References section:
Multiplexed genome regulation in vivo with hyper-efficient Cas12a. Guo LY, Bian J, Davis AE, Liu P, Kempton HR, Zhang X, Chemparathy A, Gu B, Lin X, Rane DA, Xu X, Jamiolkowski RM, Hu Y, Wang S, Qi LS. Nat Cell Biol. 2022 Apr;24(4):590-600. doi: 10.1038/s41556-022-00870-7. Epub 2022 Apr 12. 10.1038/s41556-022-00870-7 PubMed 35414015