Skip to main content
Addgene

pSLQ10878
(Plasmid #183964)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183964 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    PB
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Hygromycin ; mCherry fluorescence

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    HyperdCas12a
  • Alt name
    LbCas12a(D156R, E292R, D235R, D350R)
  • Alt name
    LbCfp1(D156R, E292R, D235R, D350R)
  • Species
    Synthetic
  • Mutation
    D156R, E292R, D235R, D350R
  • Promoter CAG
  • Tags / Fusion Proteins
    • HA (C terminal on insert)
    • mCherry (C terminal on insert)
    • Hygromycin Resistance (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer caacgtgctggttgttgtgctg
  • 3′ sequencing primer GGAAAGGACAGTGGGAGTGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ10878 was a gift from Stanley Qi (Addgene plasmid # 183964 ; http://n2t.net/addgene:183964 ; RRID:Addgene_183964)
  • For your References section:

    Multiplexed genome regulation in vivo with hyper-efficient Cas12a. Guo LY, Bian J, Davis AE, Liu P, Kempton HR, Zhang X, Chemparathy A, Gu B, Lin X, Rane DA, Xu X, Jamiolkowski RM, Hu Y, Wang S, Qi LS. Nat Cell Biol. 2022 Apr;24(4):590-600. doi: 10.1038/s41556-022-00870-7. Epub 2022 Apr 12. 10.1038/s41556-022-00870-7 PubMed 35414015