Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pX459-HypaCas9-TUBA1B_sgRNA
(Plasmid #183889)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183889 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pX459V2.0-HypaCas9
  • Total vector size (bp) 9178
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TUBA1B sgRNA spacer
  • Alt name
    Tubulin alpha
  • gRNA/shRNA sequence
    GATGCACTCACGCTGCGGGA
  • Species
    H. sapiens (human)
  • Entrez Gene
    TUBA1B (a.k.a. K-ALPHA-1)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer gagggcctatttcccatgattcc
  • 3′ sequencing primer ggccatttaccgtaagttatgtaacg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX459-HypaCas9-TUBA1B_sgRNA was a gift from Alisa Piekny (Addgene plasmid # 183889 ; http://n2t.net/addgene:183889 ; RRID:Addgene_183889)
  • For your References section:

    Cytokinetic diversity in mammalian cells is revealed by the characterization of endogenous anillin, Ect2 and RhoA. Husser MC, Ozugergin I, Resta T, Martin VJJ, Piekny AJ. Open Biol. 2022 Nov;12(11):220247. doi: 10.1098/rsob.220247. Epub 2022 Nov 23. 10.1098/rsob.220247 PubMed 36416720