pX459V2.0-HypaCas9-mRuby2
(Plasmid
#183872)
-
Purpose(Empty Backbone) pX459V2.0 plasmid expressing HypaCas9 with P2A-mRuby2 and T2A-Puro, with a sgRNA cloning site for CRISPR editing in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 183872 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepX459V2.0-HypaCas9
- Backbone size (bp) 9175
-
Modifications to backboneInsertion of P2A-mRuby2 for expression with HypaCas9 and T2A-Puro
-
Vector typeMammalian Expression, CRISPR
- Promoter Cbh
-
Selectable markersPuromycin
-
Tag
/ Fusion Protein
- HypaCas9-P2A-mRuby2-T2A-Puro
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer gagggcctatttcccatgattcc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX459V2.0-HypaCas9-mRuby2 was a gift from Alisa Piekny (Addgene plasmid # 183872 ; http://n2t.net/addgene:183872 ; RRID:Addgene_183872) -
For your References section:
Cytokinetic diversity in mammalian cells is revealed by the characterization of endogenous anillin, Ect2 and RhoA. Husser MC, Ozugergin I, Resta T, Martin VJJ, Piekny AJ. Open Biol. 2022 Nov;12(11):220247. doi: 10.1098/rsob.220247. Epub 2022 Nov 23. 10.1098/rsob.220247 PubMed 36416720
