pODN-AAVS1-mNG-CAAX
(Plasmid
#183870)
-
PurposeRepair template for the stable expression of a mNeonGreen-CAAX fusion in human cells using CRISPR/Cas9.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 183870 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJET1.2
-
Backbone manufacturerThermo Fischer Scientific
- Backbone size w/o insert (bp) 2974
- Total vector size (bp) 6724
-
Vector typeMammalian Expression, CRISPR ; Donor template
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAAVS1 homology arms with CMV-driven mNeonGreen-CAAX fusion
-
Alt nameAAVS1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3752
-
MutationHomology arms contain point mutations to remove the sgRNA target site
-
Entrez GeneAAVS1 (a.k.a. AAV)
- Promoter CMV
-
Tag
/ Fusion Protein
- mNeonGreen-CAAX
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CAACTGCTTTAACACTTGTGCCTG
- 3′ sequencing primer GTTCCTGATGAGGTGGTTAGCATAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pODN-AAVS1-mNG-CAAX was a gift from Alisa Piekny (Addgene plasmid # 183870 ; http://n2t.net/addgene:183870 ; RRID:Addgene_183870) -
For your References section:
Cytokinetic diversity in mammalian cells is revealed by the characterization of endogenous anillin, Ect2 and RhoA. Husser MC, Ozugergin I, Resta T, Martin VJJ, Piekny AJ. Open Biol. 2022 Nov;12(11):220247. doi: 10.1098/rsob.220247. Epub 2022 Nov 23. 10.1098/rsob.220247 PubMed 36416720