Lenti-TargetBC-5xTAPE-1-pegRNA-InsertBC
(Plasmid #183790)

• Purpose: A single construct out of the pool of plasmid for lineage recording experiment using DNA Ticker Tape.
• Depositing Lab: Jay Shendure
• Publication: Choi et al Nature. 2022 Jul 6. pii: 10.1038/s41586-022-04922-8. doi: 10.1038/s41586-022-04922-8.

Backbone

• Vector backbone: CROP-seq-Guide-Puro
• Backbone size w/o insert (bp): 10000
• Total vector size (bp): 9386
• Modifications to backbone: Insertion of P2A-GFP-TargetBC-5xTAPE-1 after PuroR gene, and insertion of pegRNA-InsertBC next to U6 promoter.
• Vector type: Synthetic Biology
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: P2A-eGFP-TargetBC-5xTAPE-1
• Species: Synthetic
• Insert Size (bp): 1000
• Mutation: G>A in the gRNA scaffold- please see depositor comment

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: aggaccgcgcacctggtgcatgacccgcaagcccggtgcc
• 3′ sequencing primer: aatttgtgaaagattgactggtattcttaactatgttgct

Gene/Insert 2

• Gene/Insert name: pegRNA-InsertBC
• Species: Synthetic
• Insert Size (bp): 124

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ttcttggctttatatatcttgtggaaaggacgaaacacc
• 3′ sequencing primer: tttttttaagcttggcgtaactagatcttgagacactgct

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note there is a G>A mutation in the gRNA scaffold that the depositor states may affect plasmid function. We recommend running additional diagnostic before use.

Please visit https://www.biorxiv.org/content/10.1101/2021.11.05.467388v1.full for bioRxiv preprint.