Skip to main content
Addgene

pET-PC(1-86)-H6
(Plasmid #183780)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183780 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET-11d
  • Backbone size w/o insert (bp) 5680
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Polycomb
  • Alt name
    Pc
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    258
  • Entrez Gene
    Pc (a.k.a. Dmel_CG32443, CG32443, CG7618, DmPc, Dmel\CG32443, PC, Pc-G, PcG, dPC, pc)
  • Promoter T7
  • Tag / Fusion Protein
    • 6 His Tag at the C-terminus

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site NsiI (not destroyed)
  • 5′ sequencing primer ATGACTGGTCGAGGCAAGGGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    ull length of PC clone (RE66837) was from the Berkeley Drosophila Genome Resource Center.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-PC(1-86)-H6 was a gift from Peter Harte (Addgene plasmid # 183780 ; http://n2t.net/addgene:183780 ; RRID:Addgene_183780)
  • For your References section:

    Polycomb inhibits histone acetylation by CBP by binding directly to its catalytic domain. Tie F, Banerjee R, Fu C, Stratton CA, Fang M, Harte PJ. Proc Natl Acad Sci U S A. 2016 Feb 9;113(6):E744-53. doi: 10.1073/pnas.1515465113. Epub 2016 Jan 22. 10.1073/pnas.1515465113 PubMed 26802126