pET11-PC-H6
(Plasmid #183777)

• Purpose: Express PC-H6 in E. coli. Purified PC-H6 was used for for generating antibodies in rabbits and for GST-CBP pull-down assays.
• Depositing Lab: Peter Harte
• Publication: Tie et al Proc Natl Acad Sci U S A. 2016 Feb 9;113(6):E744-53. doi: 10.1073/pnas.1515465113. Epub 2016 Jan 22.

Backbone

• Vector backbone: pET-11d
• Backbone size w/o insert (bp): 5680
• Total vector size (bp): 6874
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Polycomb
• Alt name: Pc
• Species: D. melanogaster (fly)
• Insert Size (bp): 1170
• Entrez Gene: Pc (a.k.a. Dmel_CG32443, CG32443, CG7618, DmPc, Dmel\CG32443, PC, Pc-G, PcG, dPC, pc)
• Promoter: T7
• Tag / Fusion Protein:
  • 6 His tag at the C-terminus

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: NsiI (not destroyed)
• 5′ sequencing primer: ATGACTGGTCGAGGCAAGGGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: full length of PC clone (RE66837) was from the Berkeley Drosophila Genome Resource Center.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry