pAAV-TRE-DIO-ChR2-EYFP
(Plasmid #183765)

• Purpose: This plasmid is for use with neuronal cell-type selective activity tagging. The ChR2-EYFP expression requires both neural activity and Cre recombinase.
• Depositing Lab: William Wisden
• Publication: Yu et al Science. 2022 Jul;377(6601):63-72. doi: 10.1126/science.abn0853. Epub 2022 Jun 30.

Backbone

• Vector backbone: pUC
• Backbone size w/o insert (bp): 2900
• Total vector size (bp): 6322
• Vector type: Mammalian Expression, Mouse Targeting, AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: AAV transgene -teto promoter-flex/dio-ChR2-EYFP
• Species: Synthetic
• Insert Size (bp): 3730
• Promoter: tetO promoter
• Tag / Fusion Protein:
  • ChR2-EYFP

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: ctgaagttcatctgcaccac
• 3′ sequencing primer: ctcataaagagacagcaaccag

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The ChR2-EYFP part of the insert was taken from Addgene plasmid #20298 (humanized ChR2 with H134R mutation fused to EYFP, gift from Karl Deisseroth).
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry