pPAP_BGL1
(Plasmid
#183735)
-
PurposeExpresses Aspergillus aculeatus β-glucosidase (BGL1)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 183735 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC19
- Total vector size (bp) 8507
-
Vector typeYeast Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameβ-glucosidase (AaBGL1)
-
SpeciesAspergillus aculeatus
-
Insert Size (bp)732
-
GenBank IDD64088
- Promoter AOX1 promoter
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GAAGGAAGCTGCCCTGTCTTAAAC
- 3′ sequencing primer AGTATCAAAAATGAAGCCTGCATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPAP_BGL1 was a gift from Jun Ishii (Addgene plasmid # 183735 ; http://n2t.net/addgene:183735 ; RRID:Addgene_183735) -
For your References section:
A streamlined strain engineering workflow with genome-wide screening detects enhanced protein secretion in Komagataella phaffii. Ito Y, Ishigami M, Terai G, Nakamura Y, Hashiba N, Nishi T, Nakazawa H, Hasunuma T, Asai K, Umetsu M, Ishii J, Kondo A. Commun Biol. 2022 Jun 8;5(1):561. doi: 10.1038/s42003-022-03475-w. 10.1038/s42003-022-03475-w PubMed 35676418