Skip to main content
Addgene

pPAP_scFv
(Plasmid #183733)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183733 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pUC19
  • Total vector size (bp) 6698
  • Vector type
    Yeast Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Anti-lysozyme scFv
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    732
  • Promoter AOX1 promoter
  • Tag / Fusion Protein
    • His6-tag (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GAAGGAAGCTGCCCTGTCTTAAAC
  • 3′ sequencing primer AGTATCAAAAATGAAGCCTGCATC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPAP_scFv was a gift from Jun Ishii (Addgene plasmid # 183733 ; http://n2t.net/addgene:183733 ; RRID:Addgene_183733)

  • For your References section:

    A streamlined strain engineering workflow with genome-wide screening detects enhanced protein secretion in Komagataella phaffii. Ito Y, Ishigami M, Terai G, Nakamura Y, Hashiba N, Nishi T, Nakazawa H, Hasunuma T, Asai K, Umetsu M, Ishii J, Kondo A. Commun Biol. 2022 Jun 8;5(1):561. doi: 10.1038/s42003-022-03475-w. 10.1038/s42003-022-03475-w PubMed 35676418
Related items: