Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pESC-LEU-IpgD
(Plasmid #183672)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183672 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pESC-LEU
  • Backbone manufacturer
    Agilent Technologies
  • Vector type
    Yeast Expression
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IpgD
  • Species
    Shigella flexneri 5a strain M90T plasmid pWR100
  • Promoter GAL1

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer aatatacctctatactttaacgtc
  • 3′ sequencing primer ataaatagggacctagacttcagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Galactose-inducible

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pESC-LEU-IpgD was a gift from Sergio Grinstein (Addgene plasmid # 183672 ; http://n2t.net/addgene:183672 ; RRID:Addgene_183672)
  • For your References section:

    Kinase-independent synthesis of 3-phosphorylated phosphoinositides by a phosphotransferase. Walpole GFW, Pacheco J, Chauhan N, Clark J, Anderson KE, Abbas YM, Brabant-Kirwan D, Montano-Rendon F, Liu Z, Zhu H, Brumell JH, Deiters A, Stephens LR, Hawkins PT, Hammond GRV, Grinstein S, Fairn GD. Nat Cell Biol. 2022 Apr 28. pii: 10.1038/s41556-022-00895-y. doi: 10.1038/s41556-022-00895-y. 10.1038/s41556-022-00895-y PubMed 35484249