pUG34-NES-EGFP-cPHx3
(Plasmid
#183669)
-
PurposePtdIns(3,4)P2 biosensor for expression in yeast
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 183669 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUG34
-
Backbone manufacturerGueldener U, Hegemann JH.
-
Vector typeYeast Expression
-
Selectable markersHIS3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePLEKHA1
-
Alt nameTAPP1
-
SpeciesH. sapiens (human), X. laevis (frog)
-
MutationAmino acids 169-329 (tandem trimer)
-
Entrez GenePLEKHA1 (a.k.a. TAPP1)
- Promoter MET25
-
Tag
/ Fusion Protein
- X. laevis map2k1.L(32-44)-EGFP (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer aggtggcaccttgtccaattgaac
- 3′ sequencing primer ataaatagggacctagacttcagg (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byInsert from Addgene Plasmid #116855
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUG34-NES-EGFP-cPHx3 was a gift from Sergio Grinstein (Addgene plasmid # 183669 ; http://n2t.net/addgene:183669 ; RRID:Addgene_183669) -
For your References section:
Kinase-independent synthesis of 3-phosphorylated phosphoinositides by a phosphotransferase. Walpole GFW, Pacheco J, Chauhan N, Clark J, Anderson KE, Abbas YM, Brabant-Kirwan D, Montano-Rendon F, Liu Z, Zhu H, Brumell JH, Deiters A, Stephens LR, Hawkins PT, Hammond GRV, Grinstein S, Fairn GD. Nat Cell Biol. 2022 Apr 28. pii: 10.1038/s41556-022-00895-y. doi: 10.1038/s41556-022-00895-y. 10.1038/s41556-022-00895-y PubMed 35484249