pPyCAG-mKate2-3xNLS-IRES-Pac
(Plasmid
#183618)
-
PurposeMammalian expression vector for mKate2-3xNLS from the CAG promoter. Confers puromycin resistance.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 183618 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepPyCAG-IRES-Pac
- Backbone size w/o insert (bp) 6421
- Total vector size (bp) 7222
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemKate2-3xNLS
-
SpeciesSynthetic
-
Insert Size (bp)801
- Promoter CAG
-
Tag
/ Fusion Protein
- 3xNLS (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TGCTGGTTGTTGTGCTGT
- 3′ sequencing primer CGCACACCGGCCTTATTCCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPyCAG-mKate2-3xNLS-IRES-Pac was a gift from Sally Lowell (Addgene plasmid # 183618 ; http://n2t.net/addgene:183618 ; RRID:Addgene_183618) -
For your References section:
Bone morphogenic protein signalling suppresses differentiation of pluripotent cells by maintaining expression of E-Cadherin. Malaguti M, Nistor PA, Blin G, Pegg A, Zhou X, Lowell S. Elife. 2013 Dec 17;2:e01197. doi: 10.7554/eLife.01197. 10.7554/eLife.01197 PubMed 24347544