pPyCAG-NE-EGFP-IRES-Pac
(Plasmid #183617)

• Purpose: Mammalian expression vector: CAG promoter driving expression of nuclear envelope-tethered EGFP (NLS-EGFP-EmerinTMD). Confers puromycin resistance.
• Depositing Lab: Sally Lowell
• Publication: Malaguti et al Dev Cell. 2019 Jun 11. pii: S1534-5807(19)30445-9. doi: 10.1016/j.devcel.2019.05.032.

Backbone

• Vector backbone: pPyCAG-IRES-Pac
• Backbone size w/o insert (bp): 6421
• Total vector size (bp): 7425
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EGFP
• Species: Synthetic
• Insert Size (bp): 1004
• Promoter: CAG
• Tags / Fusion Proteins:
  • NLS (N terminal on insert)
  • Human EMD transmembrane domain (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: TGCTGGTTGTTGTGCTGT
• 3′ sequencing primer: CGCACACCGGCCTTATTCCA

Resource Information

• Supplemental Documents:
  • pPyCAG-NE-EGFP-IRES-Pac.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry