pPyCAG-NE-mKate2-IRES-Hph
(Plasmid #183616)

• Purpose: Mammalian expression vector: CAG promoter driving expression of nuclear envelope-tethered mKate2 (NLS-mKate2-EmerinTMD). Confers hygromycin B resistance.
• Depositing Lab: Sally Lowell
• Publication: Blin et al PLoS Biol. 2019 Aug 9;17(8):e3000388. doi: 10.1371/journal.pbio.3000388. eCollection 2019 Aug.

Backbone

• Vector backbone: pPyCAG-IRES-Hph
• Backbone size w/o insert (bp): 6788
• Total vector size (bp): 7679
• Vector type: Mammalian Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mKate2
• Species: Synthetic
• Insert Size (bp): 891
• Promoter: CAG
• Tags / Fusion Proteins:
  • NLS (N terminal on insert)
  • Human EMD transmembrane domain (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: TGCTGGTTGTTGTGCTGT
• 3′ sequencing primer: CGCACACCGGCCTTATTCCA

Resource Information

• Supplemental Documents:
  • pPyCAG-NE-mKate2-IRES-Hph.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry