attB53-Pac-TRE-3xFlag-Neurog1-attB53
(Plasmid #183613)

• Purpose: RMCE vector to shuttle puromycin resistance and TRE-3xFlag-Neurog1 cassettes into attP50-flanked landing pad. Designed for use with pmROSA26-attP50-Neo-mKate2-3xNLS-attP50 vector (Addgene 183609).
• Depositing Lab: Sally Lowell
• Publication: Malaguti et al Development. 2022 May 26. pii: 275525. doi: 10.1242/dev.200226.

Backbone

• Vector backbone: attB53-Pac-TRE-mCherry-attB53 (Addgene 183611)
• Backbone size w/o insert (bp): 3830
• Total vector size (bp): 4667
• Vector type: Mammalian Expression ; RMCE
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Neurog1
• Alt name: Ngn1
• Species: M. musculus (mouse)
• Insert Size (bp): 837
• GenBank ID: NM_010896.3
• Entrez Gene: Neurog1 (a.k.a. AKA, Math4C, Neurod3, bHLHa6, ngn1)
• Promoter: TRE
• Tag / Fusion Protein:
  • 3xFlag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: MfeI (not destroyed)
• 5′ sequencing primer: CGTTTCCCGTTGAATATGGCTC
• 3′ sequencing primer: GAAATTTGTGATGCTATTGC

Resource Information

• Supplemental Documents:
  • attB53-Pac-TRE-3xFlag-Neurog1-attB53.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry