pPyPGK-HA-EGFP-Myc-TM-IRES-Pac
(Plasmid #183606)

• Purpose: Mammalian expression vector for membrane-tethered HA- and Myc-tagged EGFP from the mouse Pgk1 promoter. Confers puromycin resistance.
• Depositing Lab: Sally Lowell
• Publication: Malaguti et al Development. 2022 May 26. pii: 275525. doi: 10.1242/dev.200226.

Backbone

• Vector backbone: pPyPGK-IRES-Pac
• Backbone size w/o insert (bp): 5236
• Total vector size (bp): 6329
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EGFP-TM
• Species: Synthetic
• Insert Size (bp): 1093
• Promoter: Mouse Pgk1
• Tags / Fusion Proteins:
  • Mouse IgGK signal peptide (N terminal on insert)
  • HA (N terminal on insert)
  • Myc (C terminal on insert)
  • Human PDGFRB transmembrane domain (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CATTCTGCACGCTTCAAAAG
• 3′ sequencing primer: GCATTCCTTTGGCGAGAG

Resource Information

• Supplemental Documents:
  • pPyPGK-HA-EGFP-Myc-TM-IRES-Pac.gb
• A portion of this plasmid was derived from a plasmid made by: The HA-EGFP-Myc-TM cassette was a kind gift of Dr Luis Ángel Fernández (CNB-CSIC).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry