pCAG-Izumo1-1D4
(Plasmid
#183544)
-
PurposeExpression vector of mouse izumo sperm-egg fusion 1 (Izumo1) tagged with 1D4 at C-terminus.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 183544 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCAG1.1
- Backbone size w/o insert (bp) 5200
- Total vector size (bp) 6391
-
Modifications to backbonepCAGGS was used as an original vector. 1D4 sequence was added.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameizumo sperm-egg fusion 1
-
Alt nameIzumo1
-
Alt name1700058F15Rik
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1191
-
Entrez GeneIzumo1 (a.k.a. 1700058F15Rik, Izumo)
-
Tag
/ Fusion Protein
- 1D4
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GCCTTCTTCTTTTTCCTACAGC
- 3′ sequencing primer GCCACACCAGCCACCACCTTCTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-Izumo1-1D4 was a gift from Masahito Ikawa (Addgene plasmid # 183544 ; http://n2t.net/addgene:183544 ; RRID:Addgene_183544) -
For your References section:
Sperm membrane proteins DCST1 and DCST2 are required for sperm-egg interaction in mice and fish. Noda T, Blaha A, Fujihara Y, Gert KR, Emori C, Deneke VE, Oura S, Panser K, Lu Y, Berent S, Kodani M, Cabrera-Quio LE, Pauli A, Ikawa M. Commun Biol. 2022 Apr 7;5(1):332. doi: 10.1038/s42003-022-03289-w. 10.1038/s42003-022-03289-w PubMed 35393517