Skip to main content
Addgene

pCAG-Izumo1-1D4
(Plasmid #183544)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183544 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCAG1.1
  • Backbone size w/o insert (bp) 5200
  • Total vector size (bp) 6391
  • Modifications to backbone
    pCAGGS was used as an original vector. 1D4 sequence was added.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    izumo sperm-egg fusion 1
  • Alt name
    Izumo1
  • Alt name
    1700058F15Rik
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1191
  • Entrez Gene
    Izumo1 (a.k.a. 1700058F15Rik, Izumo)
  • Tag / Fusion Protein
    • 1D4

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GCCTTCTTCTTTTTCCTACAGC
  • 3′ sequencing primer GCCACACCAGCCACCACCTTCTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-Izumo1-1D4 was a gift from Masahito Ikawa (Addgene plasmid # 183544 ; http://n2t.net/addgene:183544 ; RRID:Addgene_183544)
  • For your References section:

    Sperm membrane proteins DCST1 and DCST2 are required for sperm-egg interaction in mice and fish. Noda T, Blaha A, Fujihara Y, Gert KR, Emori C, Deneke VE, Oura S, Panser K, Lu Y, Berent S, Kodani M, Cabrera-Quio LE, Pauli A, Ikawa M. Commun Biol. 2022 Apr 7;5(1):332. doi: 10.1038/s42003-022-03289-w. 10.1038/s42003-022-03289-w PubMed 35393517