Skip to main content
Addgene

pAAV-CaMKIIa-hsChRmine-oScarlet-KV 2.1-WPRE
(Plasmid #183521)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183521 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV-CaMKIIa
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 5384
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hsChRmine-oScarlet-Kv2.1
  • Species
    Synthetic; derived from Tiarina fusus
  • Insert Size (bp)
    1905
  • Mutation
    H33R
  • Promoter CaMKIIa

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CTGGATGCTGACGAAGGCTCG
  • 3′ sequencing primer GAATACCAGTCAATCTTTCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CaMKIIa-hsChRmine-oScarlet-KV 2.1-WPRE was a gift from Karl Deisseroth (Addgene plasmid # 183521 ; http://n2t.net/addgene:183521 ; RRID:Addgene_183521)
  • For your References section:

    Structural basis for channel conduction in the pump-like channelrhodopsin ChRmine. Kishi KE, Kim YS, Fukuda M, Inoue M, Kusakizako T, Wang PY, Ramakrishnan C, Byrne EFX, Thadhani E, Paggi JM, Matsui TE, Yamashita K, Nagata T, Konno M, Quirin S, Lo M, Benster T, Uemura T, Liu K, Shibata M, Nomura N, Iwata S, Nureki O, Dror RO, Inoue K, Deisseroth K, Kato HE. Cell. 2022 Feb 17;185(4):672-689.e23. doi: 10.1016/j.cell.2022.01.007. Epub 2022 Feb 2. 10.1016/j.cell.2022.01.007 PubMed 35114111