pTRIP-MND-HsMAN1C1-1-630-cMycFlag-hPGK-GFP
(Plasmid
#183505)
-
PurposeExpress GFP and MAN1C1 proteins
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 183505 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTRIP
- Total vector size (bp) 12890
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameman1C1
-
Alt nameclass I alpha-mannosidase C1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1890
-
GenBank IDNM_020379 NM_020379.3
-
Entrez GeneMAN1C1 (a.k.a. HMIC, MAN1A3, MAN1C, pp6318)
- Promoter MND
-
Tag
/ Fusion Protein
- Myc-DDK (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer 5’CTCACTCGGCGCGATCTGGATCTGCCGCCGCGATCG3’ (Forward)
- 3′ sequencing primer 5’CCCAACCCCGTGGGAATTCGTTAAACCTTATCGTCGTCATCCTTG3’ (Reverse) (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameEGFP
-
Insert Size (bp)239
- Promoter hPGK
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer 5’CACTCGGCGCGATCTGGATCCCGAATTCCCACGGGGTTG3’ (Forward)
- 3′ sequencing primer 5’CACCATGGTGGCGACCGGTGGCTGGGGAGAGAGGTCGG3’ (Reverse) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byman1c1: from pCMV6-HsMAN1C1-1-630-cMycFlag plasmid (Origene, Cat#: RC222009)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRIP-MND-HsMAN1C1-1-630-cMycFlag-hPGK-GFP was a gift from Olivier Guipaud (Addgene plasmid # 183505 ; http://n2t.net/addgene:183505 ; RRID:Addgene_183505) -
For your References section:
A role for endothelial alpha-mannosidase MAN1C1 in radiation-induced immune cell recruitment. Ladaigue S, Lefranc AC, Balde K, Quitoco M, Bacquer E, Busso D, Piton G, Depagne J, Dechamps N, Yamakawa N, Debusschere L, Han C, Allain F, Buard V, Tarlet G, Francois A, Paget V, Milliat F, Guipaud O. iScience. 2022 Nov 2;25(12):105482. doi: 10.1016/j.isci.2022.105482. eCollection 2022 Dec 22. 10.1016/j.isci.2022.105482 PubMed 36404925