pDRM166 LKB (Luciferase mKate2 Blast)
(Plasmid #183502)

• Purpose: Expresses the firefly luciferase gene, the NLS-tagged mKate2 gene, and the blasticidin resistance gene joined by P2A linkers.
• Depositing Lab: Wayne Tilley
• Publication: Mustafa et al Oncogene. 2023 Nov 24. doi: 10.1038/s41388-023-02892-3.

Backbone

• Vector backbone: pRRLSIN.cPPT.MND
• Backbone size w/o insert (bp): 6685
• Total vector size (bp): 9620
• Vector type: Mammalian Expression, Lentiviral, Luciferase
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Firefly Luciferase
• Alt name: Luc
• Species: Photinus pyralis
• Insert Size (bp): 1650
• Promoter: MND
• Tag / Fusion Protein:
  • P2A linker (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: MND-F (GTTCGCTTCTCGCTTCTGTT)

Gene/Insert 2

• Gene/Insert name: mKate2
• Species: Synthetic
• Insert Size (bp): 693
• Promoter: MND (off Luc-P2A)
• Tags / Fusion Proteins:
  • SV40 NLS with GGS linker (N terminal on backbone)
  • P2A linker (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: Luc-F (GACGAAGTACCGAAAGGTCTT)

Gene/Insert 3

• Gene/Insert name: BSD
• Alt name: Blasticidin-S deaminase/BlastR
• Species: Aspergillus terreus
• Insert Size (bp): 393
• Promoter: MND (off Luc-P2A-mKate2-P2A)

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: WPRE-R (GCGTAAAAGGAGCAACATAG)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note: Plasmid contains a V294F mutation in luciferase. This mutation is not known to affect plasmid function.