pGEM4Z-Fluc
(Plasmid
#183474)
-
PurposeThis plasmid can be used to prepare Fluc mRNA by In Vitro Transcription
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 183474 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGEM4Z
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 2600
- Total vector size (bp) 4400
-
Vector typeBacterial Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameFirefly luciferase
-
Alt nameFluc
-
SpeciesPhotinus pyralis
-
Insert Size (bp)1829
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Hind III (not destroyed)
- 3′ cloning site Sac I (not destroyed)
- 5′ sequencing primer TATAATACGACTCACTATAGGGAGACAA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEM4Z-Fluc was a gift from Chantal Pichon (Addgene plasmid # 183474 ; http://n2t.net/addgene:183474 ; RRID:Addgene_183474) -
For your References section:
Neutral Lipopolyplexes for In Vivo Delivery of Conventional and Replicative RNA Vaccine. Perche F, Clemencon R, Schulze K, Ebensen T, Guzman CA, Pichon C. Mol Ther Nucleic Acids. 2019 Sep 6;17:767-775. doi: 10.1016/j.omtn.2019.07.014. Epub 2019 Jul 30. 10.1016/j.omtn.2019.07.014 PubMed 31446119