pGAE-UFO.664
(Plasmid
#183471)
-
PurposeLentiviral vector expressing HIV Envelope UFO.664
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 183471 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsNone
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHIV envelope
-
SpeciesHuman Immunodeficiency virus type 1
-
Insert Size (bp)1925
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (destroyed during cloning)
- 3′ cloning site SalI (destroyed during cloning)
- 5′ sequencing primer atggacagagccaaactcctccttctc
- 3′ sequencing primer tca tca gtc cac ggc cag cag gtc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGAE-UFO.664 was a gift from Andrea Cara (Addgene plasmid # 183471 ; http://n2t.net/addgene:183471 ; RRID:Addgene_183471)