Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA3.1-Zeo-ssIFNG
(Plasmid #183470)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183470 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1-(-)-Zeo
  • Backbone manufacturer
    Thermofisher scientific
  • Backbone size w/o insert (bp) 5014
  • Total vector size (bp) 5489
  • Vector type
    Mammalian Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Salmo salar interferon gamma precursor
  • Alt name
    ifng
  • Species
    Salmo salar
  • Insert Size (bp)
    543
  • GenBank ID
    NP_001117030
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GGCTAACTAGAGAACCCACTG
  • 3′ sequencing primer GGCAACTAGAAGGCACAGTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Adamek et al Front Immunol. 2021 Feb 24;12:581786. doi: 10.3389/fimmu.2021.581786. eCollection 2021. https://pubmed.ncbi.nlm.nih.gov/33717065/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-Zeo-ssIFNG was a gift from Bertrand Collet (Addgene plasmid # 183470 ; http://n2t.net/addgene:183470 ; RRID:Addgene_183470)
  • For your References section:

    Isolation and activity of the promoters for STAT1 and 2 in Atlantic salmon Salmo salar. Collins C, Ganne G, Collet B. Fish Shellfish Immunol. 2014 Oct;40(2):644-7. doi: 10.1016/j.fsi.2014.07.025. Epub 2014 Aug 13. 10.1016/j.fsi.2014.07.025 PubMed 25128593