Skip to main content
Addgene

pFUGW-shRIIα
(Plasmid #183454)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183454 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pFUGW-H1 empty vector
  • Backbone manufacturer
    pFUGW-H1 empty vector was a gift from Sally Temple (Addgene plasmid # 25870 ; http://n2t.net/addgene:25870 ; RRID:Addgene_25870)
  • Backbone size w/o insert (bp) 10130
  • Vector type
    Lentiviral
  • Selectable markers
    Zeocin ; GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA targeting rat PKA-RIIα
  • gRNA/shRNA sequence
    GCCAGGAATCAGACTCGTTCA
  • Species
    R. norvegicus (rat)
  • Entrez Gene
    Prkar2a
  • Promoter shRNA: H1 / gene: ubiquitin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer shRNA (H1) - 5'tcgctatgtgttctgggaaa; Prkar2a_bp500_F - 5'GAGATGATGGAGACAACTTTTATGTC; Prkar2a_bp1000_F - 5'GGAGAACTTGCCCTGGTGACCA
  • 3′ sequencing primer 5'GTTCAGGGGGAGGTGT
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    We amplified the RIIα coding sequence from a rat hippocampal cDNA library.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Zeo marker is outside the LTRs and will not be packaged into virus.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFUGW-shRIIα was a gift from Matthew Gold (Addgene plasmid # 183454 ; http://n2t.net/addgene:183454 ; RRID:Addgene_183454)

  • For your References section:

    AKAP79 enables calcineurin to directly suppress protein kinase A activity. Church TW, Tewatia P, Hannan S, Antunes J, Eriksson O, Smart TG, Hellgren Kotaleski J, Gold MG. Elife. 2021 Oct 6;10. pii: 68164. doi: 10.7554/eLife.68164. 10.7554/eLife.68164 PubMed 34612814
Related items: