pPB-Ins-U6p-sgRNAentry-EF1Ap-TetOn3G-IRES-Neo
(Plasmid #183411)

• Purpose: piggyBAC-based sgRNA entry (Esp3I) and Tet-On 3G transactivator expression vector. Insert protospacer and transfect with CRISPRa (183409) or CRISPRi (183410) plasmid for inducible epigenome editing.
• Depositing Lab: Azim Surani
• Publication: Tang et al Nat Cell Biol. 2022 Apr;24(4):448-460. doi: 10.1038/s41556-022-00878-z. Epub 2022 Apr 11.

Backbone

• Vector backbone: PB510B-1
• Backbone manufacturer: System Biosciences
• Backbone size w/o insert (bp): 4422
• Total vector size (bp): 7322
• Modifications to backbone: EF1Apromoter and TetOn3G-IRES-Neo fragments were inserted to the pPB-Ins backbone (cut by SpeI and ApaI) by In-fusion cloning. Subsequently, a U6promoter-sgRNAentry(Esp3I)-scaffold fragment was inserted.
• Vector type: Mammalian Expression, CRISPR, Synthetic Biology ; piggyBAC
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Tet-on 3G
• Species: Synthetic
• Insert Size (bp): 747
• Promoter: EF1A

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAAGTGCAGTAGTCGCCGTG
• 3′ sequencing primer: cctaggaatgctcgtcaaga

Resource Information

• Supplemental Documents:
  • 261 pPB-Ins-U6-Esp3Ix2-gRNAopti-EF1a-tet3G-IN-Ins.gbk
• A portion of this plasmid was derived from a plasmid made by: Tetracycline controllable expression system by TET Systems
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry