CROP_C9_Puro_ROS1
(Plasmid
#183320)
-
PurposeAll-in-One CRISPRko system with a guide RNA that targets ROS1 gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 183320 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneCROPseq
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameROS1
-
gRNA/shRNA sequenceAGGCTGTGTCTGTAGTACAA
-
SpeciesSynthetic
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CROP_C9_Puro_ROS1 was a gift from Prashant Mali (Addgene plasmid # 183320 ; http://n2t.net/addgene:183320 ; RRID:Addgene_183320) -
For your References section:
Integrated genome and tissue engineering enables screening of cancer vulnerabilities in physiologically relevant perfusable ex vivo cultures. Hu M, Lei XY, Larson JD, McAlonis M, Ford K, McDonald D, Mach K, Rusert JM, Wechsler-Reya RJ, Mali P. Biomaterials. 2022 Jan;280:121276. doi: 10.1016/j.biomaterials.2021.121276. Epub 2021 Dec 2. 10.1016/j.biomaterials.2021.121276 PubMed 34890975