Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pKDsgRNA-FRT
(Plasmid #183241)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183241 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSC101 rep-ts
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin and Streptomycin, 50 & 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    sgRNA-FRT
  • gRNA/shRNA sequence
    tcctatactttctagagaat
  • Species
    Escherichia coli
  • Promoter P-tet

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Esp3I (destroyed during cloning)
  • 3′ cloning site Esp3I (destroyed during cloning)
  • 5′ sequencing primer none
  • 3′ sequencing primer TTCACTTCTGAGTTCGGCATGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKDsgRNA-FRT was a gift from Karin Schnetz (Addgene plasmid # 183241 ; http://n2t.net/addgene:183241 ; RRID:Addgene_183241)
  • For your References section:

    Deletion of FRT-sites by no-SCAR recombineering in Escherichia coli. Rangarajan AA, Yilmaz C, Schnetz K. Microbiology (Reading). 2022 Apr;168(4). doi: 10.1099/mic.0.001173. 10.1099/mic.0.001173 PubMed 35411846