pKDsgRNA-FRT
(Plasmid
#183241)
-
Purposeanhydrotetracycline (aTC) inducible sgRNA that targets FRT scar sites and arabinose inducible lambda Red
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 183241 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepSC101 rep-ts
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin and Streptomycin, 50 & 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesgRNA-FRT
-
gRNA/shRNA sequencetcctatactttctagagaat
-
SpeciesEscherichia coli
- Promoter P-tet
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Esp3I (destroyed during cloning)
- 3′ cloning site Esp3I (destroyed during cloning)
- 5′ sequencing primer none
- 3′ sequencing primer TTCACTTCTGAGTTCGGCATGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKDsgRNA-FRT was a gift from Karin Schnetz (Addgene plasmid # 183241 ; http://n2t.net/addgene:183241 ; RRID:Addgene_183241) -
For your References section:
Deletion of FRT-sites by no-SCAR recombineering in Escherichia coli. Rangarajan AA, Yilmaz C, Schnetz K. Microbiology (Reading). 2022 Apr;168(4). doi: 10.1099/mic.0.001173. 10.1099/mic.0.001173 PubMed 35411846
Map uploaded by the depositor.
