Skip to main content
Addgene

pcDNA3.1-HNF1B-WT-Flag-UTR
(Plasmid #183239)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183239 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.1-Flag-UTR
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HNF1 homeobox B
  • Alt name
    HNF1B
  • Species
    H. sapiens (human)
  • Entrez Gene
    HNF1B (a.k.a. ADTKD3, FJHN, HNF-1-beta, HNF-1B, HNF1beta, HNF2, HPC11, LF-B3, LFB3, MODY5, RCAD, T2D, TCF-2, TCF2, VHNF1)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG tag (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer actccattcgggtgttcttg
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-HNF1B-WT-Flag-UTR was a gift from Jorge Ferrer (Addgene plasmid # 183239 ; http://n2t.net/addgene:183239 ; RRID:Addgene_183239)

  • For your References section:

    The HASTER lncRNA promoter is a cis-acting transcriptional stabilizer of HNF1A. Beucher A, Miguel-Escalada I, Balboa D, De Vas MG, Maestro MA, Garcia-Hurtado J, Bernal A, Gonzalez-Franco R, Vargiu P, Heyn H, Ravassard P, Ortega S, Ferrer J. Nat Cell Biol. 2022 Oct 6. pii: 10.1038/s41556-022-00996-8. doi: 10.1038/s41556-022-00996-8. 10.1038/s41556-022-00996-8 PubMed 36202974
Related items: