Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLentiCRISPR_zeo_sgNT135
(Plasmid #183181)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183181 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLentiCRISPRv2
  • Backbone size w/o insert (bp) 12767
  • Total vector size (bp) 12787
  • Modifications to backbone
    Modified to replace PuroR gene with BleoR gene
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NT135
  • Alt name
    Non-Targeting Guide
  • gRNA/shRNA sequence
    CGCTTCCGCGGCCCGTTCAA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BSMBI (unknown if destroyed)
  • 3′ cloning site BSMBI (unknown if destroyed)
  • 5′ sequencing primer U6
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCRISPR_zeo_sgNT135 was a gift from William Kaelin (Addgene plasmid # 183181 ; http://n2t.net/addgene:183181 ; RRID:Addgene_183181)
  • For your References section:

    Sensitivity of VHL mutant kidney cancers to HIF2 inhibitors does not require an intact p53 pathway. Stransky LA, Vigeant SM, Huang B, West D, Denize T, Walton E, Signoretti S, Kaelin WG Jr. Proc Natl Acad Sci U S A. 2022 Apr 5;119(14):e2120403119. doi: 10.1073/pnas.2120403119. Epub 2022 Mar 31. 10.1073/pnas.2120403119 PubMed 35357972