pLentiCRISPR_zeo_sgTP53
(Plasmid #183180)

• Purpose: pLentiCRISPR that is selectable with zeocin with an sgRNA targeting TP53
• Depositing Lab: William Kaelin
• Publication: Stransky et al Proc Natl Acad Sci U S A. 2022 Apr 5;119(14):e2120403119. doi: 10.1073/pnas.2120403119. Epub 2022 Mar 31.

Backbone

• Vector backbone: pLentiCRISPRv2
• Backbone size w/o insert (bp): 12767
• Total vector size (bp): 12787
• Modifications to backbone: Modified to replace PuroR gene with BleoR gene
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: sgTP53
• gRNA/shRNA sequence: CCATTGTTCAATATCGTCCG
• Species: H. sapiens (human)
• Insert Size (bp): 1179
• Entrez Gene: TP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BSMBI (unknown if destroyed)
• 3′ cloning site: BSMBI (unknown if destroyed)
• 5′ sequencing primer: U6

Resource Information

• Supplemental Documents:
  • pLentiCRISPR_Zeo_sgTP53.ape

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry