Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBK086
(Plasmid #183145)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183145 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET-His6-MBP-TEV-LIC cloning vector (1M)
  • Backbone manufacturer
    Scott Gradia
  • Backbone size w/o insert (bp) 6465
  • Total vector size (bp) 9397
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MapSPARTA operon (6xHis-MBP-MapTIR-APAZ and MapAgo)
  • Alt name
    6xHis-MBP-MapTIR-APAZ
  • Alt name
    MapAgo
  • Species
    Maribacter polysiphoniae DSM 23514
  • Insert Size (bp)
    4062
  • GenBank ID
    WP_109649956.1 WP_109649955.1
  • Promoter T7
  • Tags / Fusion Proteins
    • 6xHis (N terminal on insert)
    • MBP (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gatgaagccctgaaagacgcgcag
  • 3′ sequencing primer tttgttagcagccggatctcag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBK086 was a gift from Daan Swarts (Addgene plasmid # 183145 ; http://n2t.net/addgene:183145 ; RRID:Addgene_183145)
  • For your References section:

    Short prokaryotic Argonaute systems trigger cell death upon detection of invading DNA. Koopal B, Potocnik A, Mutte SK, Aparicio-Maldonado C, Lindhoud S, Vervoort JJM, Brouns SJJ, Swarts DC. Cell. 2022 Apr 28;185(9):1471-1486.e19. doi: 10.1016/j.cell.2022.03.012. Epub 2022 Apr 4. 10.1016/j.cell.2022.03.012 PubMed 35381200