Skip to main content
Addgene

pLenti_EF1a_EV
(Plasmid #183116)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183116 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLenti-EF1a-Gate-PGK-hygro
  • Backbone size w/o insert (bp) 10000
  • Total vector size (bp) 10147
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Small multiple cloning site
  • Species
    Synthetic
  • Insert Size (bp)
    136
  • Promoter EF1a

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer 3' EF1a-fwd: CTTCCATTTCAGGTGTCGTG
  • 3′ sequencing primer 3' PGK-rev: CTTTTGAAGCGTGCAGAATG
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr. Gang Lu

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti_EF1a_EV was a gift from William Kaelin (Addgene plasmid # 183116 ; http://n2t.net/addgene:183116 ; RRID:Addgene_183116)

  • For your References section:

    Sensitivity of VHL mutant kidney cancers to HIF2 inhibitors does not require an intact p53 pathway. Stransky LA, Vigeant SM, Huang B, West D, Denize T, Walton E, Signoretti S, Kaelin WG Jr. Proc Natl Acad Sci U S A. 2022 Apr 5;119(14):e2120403119. doi: 10.1073/pnas.2120403119. Epub 2022 Mar 31. 10.1073/pnas.2120403119 PubMed 35357972
Related items:
Commonly requested with: