pLenti_EF1a_Flag_TP53_P278A
(Plasmid
#183113)
-
PurposeExpresses flag-tagged p53 with P278A mutation in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 183113 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLenti-EF1α-Gate-PGK-hygromycin
-
Backbone manufacturerGift
- Backbone size w/o insert (bp) 10053
- Total vector size (bp) 11232
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTP53
-
Alt nameLFS1, Cellular Tumor Antigen P53
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1179
-
Mutationchanged proline 278 to alanine, see depositor comments below
-
Entrez GeneTP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)
- Promoter EF1a
-
Tag
/ Fusion Protein
- FLAG
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer 3' EF1a-fwd: CTTCCATTTCAGGTGTCGTG
- 3′ sequencing primer 3' PGK-rev: CTTTTGAAGCGTGCAGAATG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: plasmid contains the P72R mutation from a common germline SNP in TP53.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti_EF1a_Flag_TP53_P278A was a gift from William Kaelin (Addgene plasmid # 183113 ; http://n2t.net/addgene:183113 ; RRID:Addgene_183113) -
For your References section:
Sensitivity of VHL mutant kidney cancers to HIF2 inhibitors does not require an intact p53 pathway. Stransky LA, Vigeant SM, Huang B, West D, Denize T, Walton E, Signoretti S, Kaelin WG Jr. Proc Natl Acad Sci U S A. 2022 Apr 5;119(14):e2120403119. doi: 10.1073/pnas.2120403119. Epub 2022 Mar 31. 10.1073/pnas.2120403119 PubMed 35357972