-
PurposeExpresses FnCas12a in Bacteroides and used for genome editing
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 183092 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepB006
- Backbone size w/o insert (bp) 5025
- Total vector size (bp) 12371
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
-
Selectable markersErythromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)E.coli S17-1
-
Growth instructionsLB
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFnCas12a, gRNA, Promoter, HAB, TetR,
-
gRNA/shRNA sequenceTACTATATTTCCCTTCCCTTTCAGA
- Promoter P1TDPGH023
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cggctgacatgggaattcccctccaccgcggtggcttaagacccactttc
- 3′ sequencing primer gaattttgatggattcatacaagcggtcggccttaaagcctccagttgttcggaatt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pB025 was a gift from Lei Dai (Addgene plasmid # 183092 ; http://n2t.net/addgene:183092 ; RRID:Addgene_183092) -
For your References section:
CRISPR/Cas-Based Genome Editing for Human Gut Commensal Bacteroides Species. Zheng L, Tan Y, Hu Y, Shen J, Qu Z, Chen X, Ho CL, Leung EL, Zhao W, Dai L. ACS Synth Biol. 2022 Jan 21;11(1):464-472. doi: 10.1021/acssynbio.1c00543. Epub 2022 Jan 6. 10.1021/acssynbio.1c00543 PubMed 34990118