pYTK001_E2Ab
(Plasmid
#183082)
-
Purpose2A peptide E2A cloned in yeast MoClo entry vector (pYTK001) for use in bi-cistronic and as the first 2A peptide in tri-cistronic construct assembly
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 183082 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepYTK001
- Backbone size w/o insert (bp) 1650
- Total vector size (bp) 1733
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameE2A
-
SpeciesSynthetic; Equine rhinitis B virus
-
Insert Size (bp)83
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CCTTTTTACGGTTCCTGGCC
- 3′ sequencing primer CTTGGACTCCTGTTGATAGATCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYTK001_E2Ab was a gift from Zhen Wang (Addgene plasmid # 183082 ; http://n2t.net/addgene:183082 ; RRID:Addgene_183082) -
For your References section:
A Well-Characterized Polycistronic-Like Gene Expression System in Yeast. Mukherjee M, Wang ZQ. Biotechnol Bioeng. 2022 Sep 27. doi: 10.1002/bit.28247. 10.1002/bit.28247 PubMed 36168285