Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGL3 RARE-d2EGFP
(Plasmid #183055)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183055 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGL3
  • Backbone size w/o insert (bp) 3350
  • Total vector size (bp) 4209
  • Modifications to backbone
    RARE element

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    d2EGFP
  • Alt name
    destabilized EGFP
  • Insert Size (bp)
    850
  • Promoter RARE, SV40

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Destabilized EGFP under the regulation of a Retinoic Acid Response Element. Half-life 2 hrs.
RARE is located before the SV40 promoter. RARE sequence: cagttgggtcatttgaaggttagcagcccgggtagggttcaccgaaagttcactcg

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3 RARE-d2EGFP was a gift from Chaya Kalcheim (Addgene plasmid # 183055 ; http://n2t.net/addgene:183055 ; RRID:Addgene_183055)
  • For your References section:

    Completion of neural crest cell production and emigration is regulated by retinoic-acid-dependent inhibition of BMP signaling. Rekler D, Kalcheim C. Elife. 2022 Apr 8;11. pii: 72723. doi: 10.7554/eLife.72723. 10.7554/eLife.72723 PubMed 35394423